HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Zostały one zobrazowane przy użyciu EnvisionPlus (Dako), zgodnie z instrukcjami producenta.11,12 Badania molekularne i mikromanipulacja oraz PCR pojedynczej komórki
Badania molekularne i mikromanipulację oraz PCR z pojedynczej komórki przeprowadzono w sposób opisany uprzednio.13,14 Przeprowadzono ilościowy test PCR w czasie rzeczywistym z wykorzystaniem dostępnego w handlu zestawu diagnostycznego (Nanogen Advanced Diagnostics) w celu ilościowego oznaczenia obciążenia HHV-6. w leukocytach krwi obwodowej dawcy, jak również w pięciu dostępnych od pacjenta wycinkach wątroby. Wyniki ilościowego PCR zostały potwierdzone przez niezależne laboratorium. Obecność DNA wirusa opryszczki (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2 i VZV), adenowirusa i poliomawirusa (JC lub BK) potwierdzono w mikromanipulowanym pojedynczym hepatocyty olbrzymiokomórkowe za pomocą analizy PCR z użyciem wcześniej opisanych protokołów.13-17 Wyniki zostały potwierdzone przez niezależne laboratorium metodą podwójnie ślepej próby.
Aby uzyskać wydajną amplifikację PCR DNA HHV-6 w pojedynczych komórkach z utrwalonych w formalinie, zatopionych w parafinie tkanek, zaprojektowano dwa nowe startery do amplifikacji fragmentu 306-bp (lewy primer, 5 ATCACGATCGGCGTGCTAT3 , prawy starter, 5 ATGGATTTCCGTGGAAGAAA3 ). Liczba cykli wynosiła 35 przy temperaturze wyżarzania 55 ° C. Warunki PCR były takie same, jak opisane wcześniej.13
Charakterystykę wariantów HHV-6 przeprowadzono przez analizę restrykcyjną produktu PCR HHV-613, a także za pomocą bardzo czułego testu PCR swoistego dla startera, jak opisano uprzednio. Ponadto, w celu uzyskania wydajnej amplifikacji PCR HHV-6 w pojedyncze komórki z utrwalonych w formalinie, zatopionych w parafinie tkanek z testem PCR specyficznym dla startera, sonda, jak pierwotnie opisał Boutolleau i wsp., 18 została użyta jako wewnętrzny primer do drugiej rundy PCR w celu wzmocnienia 113-bp fragment.
Wyniki
Badania serologiczne
W dniu przeszczepu surowica od dawcy była ujemna w kierunku IgM i dodatnia pod względem przeciwciał IgG przeciwko HHV-6 przy miano 1:80, a surowica od pacjenta była ujemna w kierunku IgM i dodatnia w kierunku przeciwciał IgG przeciwko HHV-6 w miano 1:40 (Figura 1). Po traktowaniu próbek mocznikiem miana IgG HHV-6, zarówno od dawcy jak i pacjenta, zmniejszono o czynnik 4 lub mniej (redukcja log2, .2), co wskazuje na przeciwciała o wysokiej awidności i zgodne z HHV -6 status seropozytywny.
W dniu 16 po operacji pacjent miał zarówno dodatnie miano IgM (1:40), jak i wzrost miana przeciwciał IgG przeciwko HHV-6. Zachłanność tej ostatniej była niska, co wykazano przez zmniejszenie miana IgG o czynnik 8 po przemyciu mocznikiem (od 1: 2560 do 1: 320, log2, redukcja, 3). Zmniejszenie miana przeciwciał o czynnik 8 po leczeniu mocznikiem jest łagodne i nie jest rozstrzygające dla obecności IgG o niskiej awidności u naszego pacjenta, chociaż podobne stwierdzenie u biorcy przeszczepu opisano wcześniej. 10 Ponieważ test serologiczny nie może dyskryminować między dwoma wariantami HHV-6 postawiliśmy hipotezę, że ten graniczny spadek IgG po traktowaniu mocznikiem można przypisać obecności mieszaniny przeciwciał IgG o niskiej awidności przeciwko HHV-6A i przeciwciał IgG o wysokiej awidności przeciwko HHV-6B, tak że to tło przeciwciał o wysokiej zachłanności zapobiegałoby ostrzejszemu zmniejszeniu miana IgG
[przypisy: reaktory chemiczne, sklep rehabilitacyjny, fizjoterapeuta ]

Powiązane tematy z artykułem: fizjoterapeuta reaktory chemiczne sklep rehabilitacyjny