Zapobieganie malarii u krótkoterminowych podróżników ad

Krótkie, specyficzne dla kraju oświadczenia na temat przenoszenia malarii i interaktywnych zasobów, które są regularnie aktualizowane, są dostępne w Centrach Kontroli i Zapobiegania Chorobom (CDC) (wwwn.cdc.gov/travel/yellowBookCh5-MalariaYellowFeverTable.aspx) oraz Światowej Organizacji Zdrowia (WHO) ) (www.who.int/ith/countries/en/index.html) w celu oceny ryzyka. 5, 9, 9 Klinicy, którzy nie znają lokalizacji w poszczególnych krajach, mogą zapoznać się ze szczegółowymi mapami poszczególnych krajów, które wykazują częstość występowania malarii ; mapy te są dostępne z kilku wiarygodnych źródeł.9-11 Jednak nawet przy wykorzystaniu tych zasobów wiarygodne i aktualne dane ilościowe dotyczące ryzyka specyficznego dla danego obszaru w poszczególnych krajach są niekompletne. Tabela 1. Tabela 1. Względne ryzyko malarii wśród osób podróżujących w latach 2000-2002. Czytaj dalej Zapobieganie malarii u krótkoterminowych podróżników ad

Zapobieganie malarii u krótkoterminowych podróżników

Malaria jest wywoływana przez pierwotniaka pasożyta w erytrocytach i jest przekazywana w naturze od osoby do osoby przez ukąszenie komara anopheles, który gryzie tylko od zmierzchu do świtu. Cztery główne gatunki plazmodium wywołują malarię ludzką: Plasmodium falciparum (które potencjalnie może być śmiertelne u podróżnych nieagresywnych), P. vivax, P. ovale i P. malariae. Czytaj dalej Zapobieganie malarii u krótkoterminowych podróżników

HHV-6A w Syncytial Giant-Cell Hepatitis ad 8

Ponadto postępujący spadek obciążenia wirusowego w seryjnej biopsji wątroby i próbkach osocza od pacjenta sprawia, że jest mało prawdopodobne, że zintegrowany HHV-6 został przeniesiony przez przeszczep wątroby i stabilnie zatrzymany w wątrobie biorcy. Jest również mało prawdopodobne, że DNA HHV-6 wykryty w osoczu pacjenta był po prostu wynikiem złuszczania stabilnie zainfekowanych komórek. Z drugiej strony, brak DNA HHV-6B i antygenu w osoczu i uszkodzonej tkanki wątroby u pacjenta z utajonym zakażeniem HHV-6B silnie sugeruje, że HHV-6B nie pełnił patogennej roli. Wyniki te podnoszą również kwestie dotyczące odpowiedzi immunologicznej na dwa warianty HHV-6 i dostarczają dalszych argumentów na poparcie systematycznego wirusologicznego badania przesiewowego dawców narządów. Chociaż HHV-6A i HHV-6B mają stymulować reakcje krzyżowo reaktywnych komórek T, ponieważ mają one ponad 88% homologii sekwencji, 27, 28 doniesiono, że co najmniej 7% klonów komórek T, które są reaktywne do HHV-6 wykazują specyficzne i wyraźne wzory proliferacji do wariantu A lub wariantu B in vitro.29 Aktywna infekcja HHV-6A u naszego pacjenta sugeruje, że odpowiedź immunologiczna, która została zamontowana przeciwko HHV-6B, mogła nie być ochronna wobec HHV -6A. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 8

HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

Wynik takiej analizy był negatywny w przypadku przeciwciał przeciw innym wirusom (Figura 2C). Ta sama analiza dla HHV-6A miała negatywne wyniki na próbce z biopsji wątroby bez syncytialnego zapalenia wątroby typu olbrzymiokomórkowego, zebranego rok po przeszczepie (Figura 2D). Analiza immunohistochemiczna z użyciem monoklonalnego przeciwciała H1VK p101K na próbce z biopsji wątroby uzyskanej w 18 dniu była ujemna (Figura 2E). Taka analiza wykazała intensywne wybarwienie komórek dendrytycznych pęcherzykowego reaktywnego centrum rozrodczego u pacjenta z limfadenopatią związaną z HHV-6, który został przebadany jako osobnik kontroli pozytywnej i stwierdzono, że ma DNA HHV-6B11,12 (Figura 2F). Dyskusja
U tego pacjenta aktywna infekcja HHV-6 manifestowała się jako syncytialne zapalenie wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

HHV-6A w Syncytial Giant-Cell Hepatitis ad 6

Pojedyncza gigantyczna komórka syncytialna od pacjenta jest izolowana bez uszkodzeń otaczających komórek (Panel C), pozostawiając pustą przestrzeń (Panel D). Panel E pokazuje wyniki wykrywania HHV-6 przez PCR w pięciu izolowanych syncytialnych olbrzymich komórkach od pacjenta. Produkt PCR o oczekiwanej długości (306 bp) amplifikowano w dwóch z pięciu syncytialnych gigantycznych komórek. Kontrole pozytywne są reprezentowane przez DNA ze szczepu GS HHV-6A (GS / A), pasażowanego w linii komórkowej HSB-2 i ze szczepu Z29 HHV-6B (Z29 / B), pasażowanego w linii komórkowej Molt3 . W panelu F, trawienie (Dig) specyficznym enzymem restrykcyjnym, Hindlll, wykazuje pasmo 184 bp i jedno ze 122 bp, co wskazuje na obecność HHV-6B w komórkach Molt3, podczas gdy tylko jedno pasmo 306 par zasad, co wskazuje na obecność HHV-6A wykryto w niestrawionym (Undig) DNA z linii komórkowej HSB-2 i w Próbce 5 od pacjenta. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 6

HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Zostały one zobrazowane przy użyciu EnvisionPlus (Dako), zgodnie z instrukcjami producenta.11,12 Badania molekularne i mikromanipulacja oraz PCR pojedynczej komórki
Badania molekularne i mikromanipulację oraz PCR z pojedynczej komórki przeprowadzono w sposób opisany uprzednio.13,14 Przeprowadzono ilościowy test PCR w czasie rzeczywistym z wykorzystaniem dostępnego w handlu zestawu diagnostycznego (Nanogen Advanced Diagnostics) w celu ilościowego oznaczenia obciążenia HHV-6. w leukocytach krwi obwodowej dawcy, jak również w pięciu dostępnych od pacjenta wycinkach wątroby. Wyniki ilościowego PCR zostały potwierdzone przez niezależne laboratorium. Obecność DNA wirusa opryszczki (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2 i VZV), adenowirusa i poliomawirusa (JC lub BK) potwierdzono w mikromanipulowanym pojedynczym hepatocyty olbrzymiokomórkowe za pomocą analizy PCR z użyciem wcześniej opisanych protokołów.13-17 Wyniki zostały potwierdzone przez niezależne laboratorium metodą podwójnie ślepej próby.
Aby uzyskać wydajną amplifikację PCR DNA HHV-6 w pojedynczych komórkach z utrwalonych w formalinie, zatopionych w parafinie tkanek, zaprojektowano dwa nowe startery do amplifikacji fragmentu 306-bp (lewy primer, 5 ATCACGATCGGCGTGCTAT3 , prawy starter, 5 ATGGATTTCCGTGGAAGAAA3 ). Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

HHV-6A w Syncytial Giant-Cell Hepatitis cd

Pomimo stopniowej poprawy poziomu AST i ALT wskaźniki cholestatyczne wzrosły i utrzymywała się gorączka (ryc. 1). W dniu 13, wyniki innej biopsji wątroby wykazały poprawę ostrego odrzucenia przeszczepu (nieokreślone, według klasyfikacji Banffa) i pojawienie się kilku hepatocytów z komórkami wielkimi. W dniu 16, badania mikrobiologiczne i molekularne ponownie były prawidłowe, w tym dla wyżej wymienionych wirusów, z wyjątkiem HHV-6, który był pozytywny w PCR. Dożylnie podawano gancyklowir w dawce 5 mg na kilogram masy ciała dwa razy na dobę. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis cd

HHV-6A w Syncytial Giant-Cell Hepatitis

Syncytialne zapalenie komórek olbrzymiokomórkowych jest rzadką, ale ciężką postacią zapalenia wątroby związaną z chorobami autoimmunologicznymi, reakcjami na leki i infekcjami wirusowymi. Zastosowaliśmy metody serologiczne, molekularne i immunohistochemiczne, aby znaleźć przyczynę zakaźną w przypadku syncytialnego zapalenia wielkokomórkowego zapalenia wątroby, które rozwinęło się u biorcy przeszczepu wątroby, który miał utajone zakażenie wariantem B ludzkiego herpeswirusa 6 (HHV-6B) i który otrzymał narząd od dawcy z infekcją utajoną wariantu A (HHV-6A). Na początku choroby wykrycie DNA HHV-6A (ale nie HHV-6B) w osoczu, w dotkniętej tkance wątrobowej oraz w pojedynczo mikromanipulowanych syncytialnych gigantycznych komórkach przy użyciu dwóch różnych reakcji łańcuchowej polimerazy (PCR) testy wykazały obecność aktywnego zakażenia HHV-6A u pacjenta. Ekspresję wczesnego białka swoistego dla HHV-6A, p41 / 38, ale nie późnego białka swoistego wobec HHV-6B, p101, wykazano tylko w olbrzymich komórkach wątrobowych wątroby przy braku innych patogenów zakaźnych. Te same markery aktywnej infekcji HHV-6A zostały udokumentowane w seryjnych próbkach kontrolnych od pacjenta i zniknęły tylko przy ustąpieniu syncytialnego zapalenia wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis