HHV-6A w Syncytial Giant-Cell Hepatitis ad 8

Ponadto postępujący spadek obciążenia wirusowego w seryjnej biopsji wątroby i próbkach osocza od pacjenta sprawia, że jest mało prawdopodobne, że zintegrowany HHV-6 został przeniesiony przez przeszczep wątroby i stabilnie zatrzymany w wątrobie biorcy. Jest również mało prawdopodobne, że DNA HHV-6 wykryty w osoczu pacjenta był po prostu wynikiem złuszczania stabilnie zainfekowanych komórek. Z drugiej strony, brak DNA HHV-6B i antygenu w osoczu i uszkodzonej tkanki wątroby u pacjenta z utajonym zakażeniem HHV-6B silnie sugeruje, że HHV-6B nie pełnił patogennej roli. Wyniki te podnoszą również kwestie dotyczące odpowiedzi immunologicznej na dwa warianty HHV-6 i dostarczają dalszych argumentów na poparcie systematycznego wirusologicznego badania przesiewowego dawców narządów. Chociaż HHV-6A i HHV-6B mają stymulować reakcje krzyżowo reaktywnych komórek T, ponieważ mają one ponad 88% homologii sekwencji, 27, 28 doniesiono, że co najmniej 7% klonów komórek T, które są reaktywne do HHV-6 wykazują specyficzne i wyraźne wzory proliferacji do wariantu A lub wariantu B in vitro.29 Aktywna infekcja HHV-6A u naszego pacjenta sugeruje, że odpowiedź immunologiczna, która została zamontowana przeciwko HHV-6B, mogła nie być ochronna wobec HHV -6A. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 8

HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

Wynik takiej analizy był negatywny w przypadku przeciwciał przeciw innym wirusom (Figura 2C). Ta sama analiza dla HHV-6A miała negatywne wyniki na próbce z biopsji wątroby bez syncytialnego zapalenia wątroby typu olbrzymiokomórkowego, zebranego rok po przeszczepie (Figura 2D). Analiza immunohistochemiczna z użyciem monoklonalnego przeciwciała H1VK p101K na próbce z biopsji wątroby uzyskanej w 18 dniu była ujemna (Figura 2E). Taka analiza wykazała intensywne wybarwienie komórek dendrytycznych pęcherzykowego reaktywnego centrum rozrodczego u pacjenta z limfadenopatią związaną z HHV-6, który został przebadany jako osobnik kontroli pozytywnej i stwierdzono, że ma DNA HHV-6B11,12 (Figura 2F). Dyskusja
U tego pacjenta aktywna infekcja HHV-6 manifestowała się jako syncytialne zapalenie wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

HHV-6A w Syncytial Giant-Cell Hepatitis ad 6

Pojedyncza gigantyczna komórka syncytialna od pacjenta jest izolowana bez uszkodzeń otaczających komórek (Panel C), pozostawiając pustą przestrzeń (Panel D). Panel E pokazuje wyniki wykrywania HHV-6 przez PCR w pięciu izolowanych syncytialnych olbrzymich komórkach od pacjenta. Produkt PCR o oczekiwanej długości (306 bp) amplifikowano w dwóch z pięciu syncytialnych gigantycznych komórek. Kontrole pozytywne są reprezentowane przez DNA ze szczepu GS HHV-6A (GS / A), pasażowanego w linii komórkowej HSB-2 i ze szczepu Z29 HHV-6B (Z29 / B), pasażowanego w linii komórkowej Molt3 . W panelu F, trawienie (Dig) specyficznym enzymem restrykcyjnym, Hindlll, wykazuje pasmo 184 bp i jedno ze 122 bp, co wskazuje na obecność HHV-6B w komórkach Molt3, podczas gdy tylko jedno pasmo 306 par zasad, co wskazuje na obecność HHV-6A wykryto w niestrawionym (Undig) DNA z linii komórkowej HSB-2 i w Próbce 5 od pacjenta. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 6

HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Zostały one zobrazowane przy użyciu EnvisionPlus (Dako), zgodnie z instrukcjami producenta.11,12 Badania molekularne i mikromanipulacja oraz PCR pojedynczej komórki
Badania molekularne i mikromanipulację oraz PCR z pojedynczej komórki przeprowadzono w sposób opisany uprzednio.13,14 Przeprowadzono ilościowy test PCR w czasie rzeczywistym z wykorzystaniem dostępnego w handlu zestawu diagnostycznego (Nanogen Advanced Diagnostics) w celu ilościowego oznaczenia obciążenia HHV-6. w leukocytach krwi obwodowej dawcy, jak również w pięciu dostępnych od pacjenta wycinkach wątroby. Wyniki ilościowego PCR zostały potwierdzone przez niezależne laboratorium. Obecność DNA wirusa opryszczki (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2 i VZV), adenowirusa i poliomawirusa (JC lub BK) potwierdzono w mikromanipulowanym pojedynczym hepatocyty olbrzymiokomórkowe za pomocą analizy PCR z użyciem wcześniej opisanych protokołów.13-17 Wyniki zostały potwierdzone przez niezależne laboratorium metodą podwójnie ślepej próby.
Aby uzyskać wydajną amplifikację PCR DNA HHV-6 w pojedynczych komórkach z utrwalonych w formalinie, zatopionych w parafinie tkanek, zaprojektowano dwa nowe startery do amplifikacji fragmentu 306-bp (lewy primer, 5 ATCACGATCGGCGTGCTAT3 , prawy starter, 5 ATGGATTTCCGTGGAAGAAA3 ). Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

HHV-6A w Syncytial Giant-Cell Hepatitis cd

Pomimo stopniowej poprawy poziomu AST i ALT wskaźniki cholestatyczne wzrosły i utrzymywała się gorączka (ryc. 1). W dniu 13, wyniki innej biopsji wątroby wykazały poprawę ostrego odrzucenia przeszczepu (nieokreślone, według klasyfikacji Banffa) i pojawienie się kilku hepatocytów z komórkami wielkimi. W dniu 16, badania mikrobiologiczne i molekularne ponownie były prawidłowe, w tym dla wyżej wymienionych wirusów, z wyjątkiem HHV-6, który był pozytywny w PCR. Dożylnie podawano gancyklowir w dawce 5 mg na kilogram masy ciała dwa razy na dobę. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis cd

HHV-6A w Syncytial Giant-Cell Hepatitis

Syncytialne zapalenie komórek olbrzymiokomórkowych jest rzadką, ale ciężką postacią zapalenia wątroby związaną z chorobami autoimmunologicznymi, reakcjami na leki i infekcjami wirusowymi. Zastosowaliśmy metody serologiczne, molekularne i immunohistochemiczne, aby znaleźć przyczynę zakaźną w przypadku syncytialnego zapalenia wielkokomórkowego zapalenia wątroby, które rozwinęło się u biorcy przeszczepu wątroby, który miał utajone zakażenie wariantem B ludzkiego herpeswirusa 6 (HHV-6B) i który otrzymał narząd od dawcy z infekcją utajoną wariantu A (HHV-6A). Na początku choroby wykrycie DNA HHV-6A (ale nie HHV-6B) w osoczu, w dotkniętej tkance wątrobowej oraz w pojedynczo mikromanipulowanych syncytialnych gigantycznych komórkach przy użyciu dwóch różnych reakcji łańcuchowej polimerazy (PCR) testy wykazały obecność aktywnego zakażenia HHV-6A u pacjenta. Ekspresję wczesnego białka swoistego dla HHV-6A, p41 / 38, ale nie późnego białka swoistego wobec HHV-6B, p101, wykazano tylko w olbrzymich komórkach wątrobowych wątroby przy braku innych patogenów zakaźnych. Te same markery aktywnej infekcji HHV-6A zostały udokumentowane w seryjnych próbkach kontrolnych od pacjenta i zniknęły tylko przy ustąpieniu syncytialnego zapalenia wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis

Kompleksowa terapia ekstensywnie lekoopornej gruźlicy ad 9

Ci pacjenci mogą zatem reprezentować kohortę przeżycia. Niemożliwe jest jednak oszacowanie wpływu błędu stronniczego na wyniki leczenia w przypadku braku grupy porównawczej – tj. Pacjentów z gruźlicą o dużej oporności na leki, którzy nie byli wcześniej leczeni. Można dokonać jednego istotnego porównania pomiędzy tymi, którzy mają więcej i tymi, którzy są mniej narażeni na wcześniejsze leczenie: większa ekspozycja wiąże się ze zwiększonym, a nie zmniejszonym ryzykiem zgonu. Ponieważ w warunkach programowych powszechne jest, że leczenie gruźlicy opornej na wiele leków lub gruźlicy opornej na leki jest zarezerwowane dla pacjentów, którzy otrzymali wielokrotne leczenie gruźlicy, nasze wyniki można uogólnić na wiele populacji pacjentów leczonych w krajach o niskim i średnim dochodzie . Czytaj dalej Kompleksowa terapia ekstensywnie lekoopornej gruźlicy ad 9

Kompleksowa terapia ekstensywnie lekoopornej gruźlicy ad 8

Mniej niż 20% badanych pacjentów było wcześniej przyjmowanych do szpitala. Jest więc nieprawdopodobne, że szpitalne zakażenie gruźlicy o wysokiej oporności stanowiło chorobę w tej grupie. Rzeczywiście, u pacjentów w Peru, szeroko oparta na lekach gruźlica prawdopodobnie odzwierciedlała progresywne nabywanie mutacji lekooporności podczas sekwencyjnego narażenia na nieadekwatne schematy leczenia; pacjenci z gruźlicą o dużej oporności na leki otrzymywali jeszcze wcześniejszą terapię niż pacjenci z wielolekooporną gruźlicą, którzy wcześniej byli leczeni. Rozwój gruźlicy o dużej oporności na leki jest nieunikniony, gdy stosuje się środki do wstrzykiwania i fluorochinolony, ze względu na selekcję spontanicznie występujących opornych mutantów .5,5,46 Szybkość i stopień pojawienia się oporności mogą jednak wynikać z ostrożnego stosowania tych środków. Opór ten prawdopodobnie odzwierciedla niebezpieczeństwo stosowania leków drugiej linii w niekontrolowanych sytuacjach lub w ramach niewłaściwych schematów.47 W Peru, podobnie jak w wielu krajach, prywatni lekarze przepisywali aminoglikozydy i fluorochinolony na gruźlicę, zanim środki te zostały formalnie wprowadzone jako część schematów leczenia. Czytaj dalej Kompleksowa terapia ekstensywnie lekoopornej gruźlicy ad 8