HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

Wynik takiej analizy był negatywny w przypadku przeciwciał przeciw innym wirusom (Figura 2C). Ta sama analiza dla HHV-6A miała negatywne wyniki na próbce z biopsji wątroby bez syncytialnego zapalenia wątroby typu olbrzymiokomórkowego, zebranego rok po przeszczepie (Figura 2D). Analiza immunohistochemiczna z użyciem monoklonalnego przeciwciała H1VK p101K na próbce z biopsji wątroby uzyskanej w 18 dniu była ujemna (Figura 2E). Taka analiza wykazała intensywne wybarwienie komórek dendrytycznych pęcherzykowego reaktywnego centrum rozrodczego u pacjenta z limfadenopatią związaną z HHV-6, który został przebadany jako osobnik kontroli pozytywnej i stwierdzono, że ma DNA HHV-6B11,12 (Figura 2F). Dyskusja
U tego pacjenta aktywna infekcja HHV-6 manifestowała się jako syncytialne zapalenie wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

HHV-6A w Syncytial Giant-Cell Hepatitis ad 6

Pojedyncza gigantyczna komórka syncytialna od pacjenta jest izolowana bez uszkodzeń otaczających komórek (Panel C), pozostawiając pustą przestrzeń (Panel D). Panel E pokazuje wyniki wykrywania HHV-6 przez PCR w pięciu izolowanych syncytialnych olbrzymich komórkach od pacjenta. Produkt PCR o oczekiwanej długości (306 bp) amplifikowano w dwóch z pięciu syncytialnych gigantycznych komórek. Kontrole pozytywne są reprezentowane przez DNA ze szczepu GS HHV-6A (GS / A), pasażowanego w linii komórkowej HSB-2 i ze szczepu Z29 HHV-6B (Z29 / B), pasażowanego w linii komórkowej Molt3 . W panelu F, trawienie (Dig) specyficznym enzymem restrykcyjnym, Hindlll, wykazuje pasmo 184 bp i jedno ze 122 bp, co wskazuje na obecność HHV-6B w komórkach Molt3, podczas gdy tylko jedno pasmo 306 par zasad, co wskazuje na obecność HHV-6A wykryto w niestrawionym (Undig) DNA z linii komórkowej HSB-2 i w Próbce 5 od pacjenta. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 6

HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Zostały one zobrazowane przy użyciu EnvisionPlus (Dako), zgodnie z instrukcjami producenta.11,12 Badania molekularne i mikromanipulacja oraz PCR pojedynczej komórki
Badania molekularne i mikromanipulację oraz PCR z pojedynczej komórki przeprowadzono w sposób opisany uprzednio.13,14 Przeprowadzono ilościowy test PCR w czasie rzeczywistym z wykorzystaniem dostępnego w handlu zestawu diagnostycznego (Nanogen Advanced Diagnostics) w celu ilościowego oznaczenia obciążenia HHV-6. w leukocytach krwi obwodowej dawcy, jak również w pięciu dostępnych od pacjenta wycinkach wątroby. Wyniki ilościowego PCR zostały potwierdzone przez niezależne laboratorium. Obecność DNA wirusa opryszczki (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2 i VZV), adenowirusa i poliomawirusa (JC lub BK) potwierdzono w mikromanipulowanym pojedynczym hepatocyty olbrzymiokomórkowe za pomocą analizy PCR z użyciem wcześniej opisanych protokołów.13-17 Wyniki zostały potwierdzone przez niezależne laboratorium metodą podwójnie ślepej próby.
Aby uzyskać wydajną amplifikację PCR DNA HHV-6 w pojedynczych komórkach z utrwalonych w formalinie, zatopionych w parafinie tkanek, zaprojektowano dwa nowe startery do amplifikacji fragmentu 306-bp (lewy primer, 5 ATCACGATCGGCGTGCTAT3 , prawy starter, 5 ATGGATTTCCGTGGAAGAAA3 ). Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4