HHV-6A w Syncytial Giant-Cell Hepatitis ad 8

Ponadto postępujący spadek obciążenia wirusowego w seryjnej biopsji wątroby i próbkach osocza od pacjenta sprawia, że jest mało prawdopodobne, że zintegrowany HHV-6 został przeniesiony przez przeszczep wątroby i stabilnie zatrzymany w wątrobie biorcy. Jest również mało prawdopodobne, że DNA HHV-6 wykryty w osoczu pacjenta był po prostu wynikiem złuszczania stabilnie zainfekowanych komórek. Z drugiej strony, brak DNA HHV-6B i antygenu w osoczu i uszkodzonej tkanki wątroby u pacjenta z utajonym zakażeniem HHV-6B silnie sugeruje, że HHV-6B nie pełnił patogennej roli. Wyniki te podnoszą również kwestie dotyczące odpowiedzi immunologicznej na dwa warianty HHV-6 i dostarczają dalszych argumentów na poparcie systematycznego wirusologicznego badania przesiewowego dawców narządów. Chociaż HHV-6A i HHV-6B mają stymulować reakcje krzyżowo reaktywnych komórek T, ponieważ mają one ponad 88% homologii sekwencji, 27, 28 doniesiono, że co najmniej 7% klonów komórek T, które są reaktywne do HHV-6 wykazują specyficzne i wyraźne wzory proliferacji do wariantu A lub wariantu B in vitro.29 Aktywna infekcja HHV-6A u naszego pacjenta sugeruje, że odpowiedź immunologiczna, która została zamontowana przeciwko HHV-6B, mogła nie być ochronna wobec HHV -6A. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 8

HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Zostały one zobrazowane przy użyciu EnvisionPlus (Dako), zgodnie z instrukcjami producenta.11,12 Badania molekularne i mikromanipulacja oraz PCR pojedynczej komórki
Badania molekularne i mikromanipulację oraz PCR z pojedynczej komórki przeprowadzono w sposób opisany uprzednio.13,14 Przeprowadzono ilościowy test PCR w czasie rzeczywistym z wykorzystaniem dostępnego w handlu zestawu diagnostycznego (Nanogen Advanced Diagnostics) w celu ilościowego oznaczenia obciążenia HHV-6. w leukocytach krwi obwodowej dawcy, jak również w pięciu dostępnych od pacjenta wycinkach wątroby. Wyniki ilościowego PCR zostały potwierdzone przez niezależne laboratorium. Obecność DNA wirusa opryszczki (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2 i VZV), adenowirusa i poliomawirusa (JC lub BK) potwierdzono w mikromanipulowanym pojedynczym hepatocyty olbrzymiokomórkowe za pomocą analizy PCR z użyciem wcześniej opisanych protokołów.13-17 Wyniki zostały potwierdzone przez niezależne laboratorium metodą podwójnie ślepej próby.
Aby uzyskać wydajną amplifikację PCR DNA HHV-6 w pojedynczych komórkach z utrwalonych w formalinie, zatopionych w parafinie tkanek, zaprojektowano dwa nowe startery do amplifikacji fragmentu 306-bp (lewy primer, 5 ATCACGATCGGCGTGCTAT3 , prawy starter, 5 ATGGATTTCCGTGGAAGAAA3 ). Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

HHV-6A w Syncytial Giant-Cell Hepatitis

Syncytialne zapalenie komórek olbrzymiokomórkowych jest rzadką, ale ciężką postacią zapalenia wątroby związaną z chorobami autoimmunologicznymi, reakcjami na leki i infekcjami wirusowymi. Zastosowaliśmy metody serologiczne, molekularne i immunohistochemiczne, aby znaleźć przyczynę zakaźną w przypadku syncytialnego zapalenia wielkokomórkowego zapalenia wątroby, które rozwinęło się u biorcy przeszczepu wątroby, który miał utajone zakażenie wariantem B ludzkiego herpeswirusa 6 (HHV-6B) i który otrzymał narząd od dawcy z infekcją utajoną wariantu A (HHV-6A). Na początku choroby wykrycie DNA HHV-6A (ale nie HHV-6B) w osoczu, w dotkniętej tkance wątrobowej oraz w pojedynczo mikromanipulowanych syncytialnych gigantycznych komórkach przy użyciu dwóch różnych reakcji łańcuchowej polimerazy (PCR) testy wykazały obecność aktywnego zakażenia HHV-6A u pacjenta. Ekspresję wczesnego białka swoistego dla HHV-6A, p41 / 38, ale nie późnego białka swoistego wobec HHV-6B, p101, wykazano tylko w olbrzymich komórkach wątrobowych wątroby przy braku innych patogenów zakaźnych. Te same markery aktywnej infekcji HHV-6A zostały udokumentowane w seryjnych próbkach kontrolnych od pacjenta i zniknęły tylko przy ustąpieniu syncytialnego zapalenia wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis

Kompleksowa terapia ekstensywnie lekoopornej gruźlicy ad 7

Z powodu braku leczenia tylko trzech pacjentów z gruźlicą o dużej oporności na leki, dodatkowa toksyczność jest mało prawdopodobnym wpływem. Po drugie, chirurgia resekcyjna była wskazana u pacjentów z wysokim stopniem oporności, względnie umiejscowioną chorobą i brakiem początkowej odpowiedzi, nawet u pacjentów z ograniczoną objętością płuc.22 U pacjentów poddawanych zabiegom chirurgicznym przedłużono leczenie. Słabe wyniki wśród pacjentów z ciężko chorym na gruźlicę operacjami były rzadsze (28,6%) niż wśród wszystkich pacjentów z gruźlicą o dużej oporności na leki (39,6%). Ponieważ pacjenci, u których leczenie nie powiodło się lub zmarli, nie kwalifikowali się do zabiegu, nie możemy jednak wyciągnąć przyczynowego wniosku o jego skuteczności. Zażywanie kortykosteroidów, choć nie rejestrowane, było częste.24 Inne terapie wspomagające zostały odrzucone z powodu braku dowodów.40-44
Po trzecie, częsty kontakt z pracownikami służby zdrowia przyniósł wiele korzyści. Czytaj dalej Kompleksowa terapia ekstensywnie lekoopornej gruźlicy ad 7

Monocytowa limfocytoza limfocytowa B i przewlekła białaczka limfatyczna ad 6

Z definicji niedokrwistość w momencie rozpoznania fenotypu CLL-MBL nie była autoimmunologiczna ani spowodowana infiltracją szpiku kostnego przez CLL. Spośród 62 osób, które zmarły, 13 miało postępującą CLL, ale zostało to uznane za przyczynę śmierci tylko w 4. Dyskusja
MBL jest stosunkowo nową kategorią diagnostyczną, która odzwierciedla zdolność wysoce czułej cytometrii przepływowej do wykrywania komórek fenotypowych CLL na niskim poziomie podczas rutynowych badań w poszukiwaniu niespokrewnionych zaburzeń lub badań przesiewowych. Oddzielenie fenotypu CLL MBL od CLL jest ważne, ponieważ fenotyp CLL-MBL niekoniecznie ewoluuje do CLL.
Komórki z fenotypem CLL są wykrywalne u ponad 3% dorosłych4,5 i ponad 10% osób z więcej niż dwoma krewnymi pierwszego stopnia dotkniętymi CLL.16,17 Fenotyp CLL jest zawsze związany z monoklonalną immunoglobuliną powierzchniową.4,5 , 17 Wstępne doniesienia wskazują, że białka takie jak CD81 i informacyjny RNA, takie jak czynnik wiążący czynnik limfatyczny 1, które ulegają nienormalnej ekspresji w CLL, wykazują podobny wzór w fenotypie CLL-MBL.18,19 Nasze badanie wykazało, że komórki fenotypowe CLL może mieć nieprawidłowości chromosomalne, w szczególności delecję 13q14, która występuje przy podobnych częstotliwościach w fenolu CLL-MBL i w PBL. Czytaj dalej Monocytowa limfocytoza limfocytowa B i przewlekła białaczka limfatyczna ad 6

Monocytowa limfocytoza limfocytowa B i przewlekła białaczka limfatyczna ad 5

Kaplan-Meier Estymaty wyników wśród osób z PBL z fenotypem PBL i limfocytozą. Panel A pokazuje odsetek osób pozostających przy życiu oraz odsetek osób, które przeżyły i nie były leczone z powodu CLL. Panel B pokazuje odsetek osobników ze stabilnym MBL z fenotypem CLL, zdefiniowanym jako brak objawów lub cech CLL i utrzymanie stabilnej liczby limfocytów (liczba mniejsza niż dwukrotnie w prezentacji). Tabela 3. Tabela 3. Czytaj dalej Monocytowa limfocytoza limfocytowa B i przewlekła białaczka limfatyczna ad 5

Nieobecność błędu płci w skierowaniu pacjentów do cewnikowania serca

Ostatnie doniesienia zwróciły uwagę na różnice w diagnostycznym i terapeutycznym podejściu lekarzy do mężczyzn i kobiet ze stwierdzoną lub podejrzewaną chorobą wieńcową1-7. Tobin i współpracownicy stwierdzili, że tylko 4 procent kobiet z nieprawidłowym skanu radionuklidów podczas ćwiczeń zostało skierowanych przez swoich lekarzy do cewnikowania serca, w porównaniu z 40 procentami mężczyzn z podobnymi wynikami1. Kolejne badania wykazały niższą częstość występowania w kierunku cewnikowania serca u kobiet niż u mężczyzn hospitalizowanych z powodu zawału mięśnia sercowego2,3,6,7 i innych objawów choroby wieńcowej3. Chociaż kobiety różnią się od mężczyzn późniejszym wystąpieniem choroby wieńcowej i mniejszą częstością występowania choroby w danym wieku, 8-11 prób kontrolowania tych czynników nie wyeliminowało zaobserwowanych różnic, pozostawiając otwartą możliwość, że różnice w lekarzach podejmowano decyzje w oparciu o płeć pacjenta. Dostarczenie ostatecznych dowodów na uprzedzenia seksualne wymagałoby wykazania, że lekarze podejmowali różne decyzje dotyczące leczenia pacjentów, którzy byli podobni, z wyjątkiem ich płci12. Czytaj dalej Nieobecność błędu płci w skierowaniu pacjentów do cewnikowania serca

Ograniczenie potrzeby amniopunkcji u kobiet w wieku 35 lat lub starszych ze wskaźnikami surowicy do badań przesiewowych ad

Szacunki dotyczące wieku ciążowego były dostępne dla ponad 99 procent ciąż, w oparciu zarówno o datę ostatniej miesiączki, jak i wyniki ultrasonografii. Wśród tych kobiet 71% to nie-Latynosi, 13% to Hiszpanie, 10% to Azjaci, a 6% to czarni. Pobrano próbkę krwi i odwirowano, a surowicę przechowywano w lodówce do momentu tuż przed wysyłką. Próbkę wysłano przez noc w ciągu jednego do pięciu dni po jej pobraniu do centralnego laboratorium w Scarborough, Maine, w celu analizy alfa-fetoproteiny, nieskoniugowanego estriolu i ludzkiej gonadotropiny kosmówkowej (łącznie określanych dalej jako markery biochemiczne). Analizy przeprowadzono w ciągu dwóch dni po przybyciu próbki, ale wyniki nie zostały udostępnione do celów klinicznych. Czytaj dalej Ograniczenie potrzeby amniopunkcji u kobiet w wieku 35 lat lub starszych ze wskaźnikami surowicy do badań przesiewowych ad