HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

Wynik takiej analizy był negatywny w przypadku przeciwciał przeciw innym wirusom (Figura 2C). Ta sama analiza dla HHV-6A miała negatywne wyniki na próbce z biopsji wątroby bez syncytialnego zapalenia wątroby typu olbrzymiokomórkowego, zebranego rok po przeszczepie (Figura 2D). Analiza immunohistochemiczna z użyciem monoklonalnego przeciwciała H1VK p101K na próbce z biopsji wątroby uzyskanej w 18 dniu była ujemna (Figura 2E). Taka analiza wykazała intensywne wybarwienie komórek dendrytycznych pęcherzykowego reaktywnego centrum rozrodczego u pacjenta z limfadenopatią związaną z HHV-6, który został przebadany jako osobnik kontroli pozytywnej i stwierdzono, że ma DNA HHV-6B11,12 (Figura 2F). Dyskusja
U tego pacjenta aktywna infekcja HHV-6 manifestowała się jako syncytialne zapalenie wątroby typu olbrzymiokomórkowego. Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis ad 7

HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Zostały one zobrazowane przy użyciu EnvisionPlus (Dako), zgodnie z instrukcjami producenta.11,12 Badania molekularne i mikromanipulacja oraz PCR pojedynczej komórki
Badania molekularne i mikromanipulację oraz PCR z pojedynczej komórki przeprowadzono w sposób opisany uprzednio.13,14 Przeprowadzono ilościowy test PCR w czasie rzeczywistym z wykorzystaniem dostępnego w handlu zestawu diagnostycznego (Nanogen Advanced Diagnostics) w celu ilościowego oznaczenia obciążenia HHV-6. w leukocytach krwi obwodowej dawcy, jak również w pięciu dostępnych od pacjenta wycinkach wątroby. Wyniki ilościowego PCR zostały potwierdzone przez niezależne laboratorium. Obecność DNA wirusa opryszczki (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2 i VZV), adenowirusa i poliomawirusa (JC lub BK) potwierdzono w mikromanipulowanym pojedynczym hepatocyty olbrzymiokomórkowe za pomocą analizy PCR z użyciem wcześniej opisanych protokołów.13-17 Wyniki zostały potwierdzone przez niezależne laboratorium metodą podwójnie ślepej próby.
Aby uzyskać wydajną amplifikację PCR DNA HHV-6 w pojedynczych komórkach z utrwalonych w formalinie, zatopionych w parafinie tkanek, zaprojektowano dwa nowe startery do amplifikacji fragmentu 306-bp (lewy primer, 5 ATCACGATCGGCGTGCTAT3 , prawy starter, 5 ATGGATTTCCGTGGAAGAAA3 ). Czytaj dalej HHV-6A w Syncytial Giant-Cell Hepatitis czesc 4

Ograniczenie potrzeby amniopunkcji u kobiet w wieku 35 lat lub starszych ze wskaźnikami surowicy do badań przesiewowych ad 5

Koszt pojedynczego przypadku wykryty w drugim trymestrze przy obecnych praktykach wyniósłby 100 000 USD w porównaniu z 36 500 USD na badania biochemiczne. Odpowiednie szacowane koszty na niemowlę urodzone na żywo z zespołem Downa wyniosłyby odpowiednio 130 000 USD i 47 000 USD (około 23 procent płodów z zespołem Downa zostało samoistnie przerwanych w trzecim trymestrze). Analiza ta nie obejmuje dodatkowych bezpośrednich kosztów opieki zdrowotnej i kosztów społecznych związanych z opieką nad szacowanymi ośmioma żywymi dziećmi z zespołem Downa, które nie zostałyby wykryte w badaniach biochemicznych; pozostałe trzy zostaną spontanicznie utracone w trzecim trymestrze. Wykrywanie tych ośmiu przypadków wymagałoby dodatkowych wydatków w wysokości 6,75 miliona USD (840 000 USD na jeden przypadek). Gdy liczby te są ekstrapolowane na szacunkowe 380 000 ciąż występujących każdego roku u kobiet w wieku 35 lat lub starszych w Stanach Zjednoczonych, redukcja kosztów diagnostycznych wynikających z zastosowania wielu markowych badań biochemicznych wyniosłaby około 250 milionów USD (zakładając całkowite uczestnictwo ). Czytaj dalej Ograniczenie potrzeby amniopunkcji u kobiet w wieku 35 lat lub starszych ze wskaźnikami surowicy do badań przesiewowych ad 5